Liver cancer ranks the fourth leading cause of cancer-related deaths worldwide, with more than 8.4 million new cases. Hepatocellular carcinoma (HCC) is the most common type of liver cancers. In this study, the computational approach was used to develop an RNA aptamer against the AFP protein, which is the most commonly used biomarker for HCC. Random RNA sequences were used as a source for the study, and several rounds of mutations have been introduced to these sequences in order to enhance binding affinity. Molecular docking, and molecular dynamics were utilized to screen aptamers and characterize the detailed interactions between the selected aptamer and the protein. As a result, the selected aptamer (5′ GGAUCGGUGGCCAAGUUAGUCAAACCCCGUGUGCCGGUUUAGCAUAGCCCCGAUCC

-3′) showed good binding affinity to the target AFP. The RMSF, hydrogen bonds,and RMSD analysis showed that the aptamer-protein complex had lower flexibility, stable, and compact during the time of the simulation. Thus, it can serve as a good candidate for the diagnosis or treatment of liver cancer.