Cockroaches, considered one of the oldest and most winged insects, are a common urban pest, mostly found in tropical regions. Periplaneta americana, a globally invasive pest, poses economic and health risks due to its common closeness to humans. The morphological identification of Periplaneta species is challenging due to their similarities, so the present work is designed to identify P. americana molecularly by mitochondrial cytochrome c oxidase subunit I (MT-COI) extraction technique, which supports morphological taxonomies. From May 2021 to mid-July 2023, 377 specimens were collected from 18 localities in four Kurdistan Region-Iraq governorates (Duhok, Erbil, Sulaymaniyah, and Halabja). Individual MT-COI extraction was performed on 28 specimens after morphological identification, then amplified with primers SHam-IS-F (CTGTTCCGGCACCTCTTTCT) and SHam-IS-R (CGGGCAACCAGGTTCACTAA) through polymerase chain reaction (PCR), and its products were visualized on a 1.5% agarose gel electrophoresis, then sequenced by Korea's Macrogen Co. After sequencing, Basic Local Alignment Searching Tools (BLAST) were used to compare the sequences to GenBank homologs. Finally, MEGA11 was used to evaluate the evolutionary relationships of the specimens and closely related species. The PCR method amplified 250 bp of the MT-COI gene, and the phylogenetic research and BLAST findings showed the cockroach CO1 gene resembled P. americana. The sequencing results were submitted to GenBank and identified under the following accession numbers for the first time in the Kurdistan Region, Iraq: OQ396670.1, OQ396671.1, OQ396672.1, OQ396673.1, OQ422974.1, OQ422975.1, OQ422976.1, OQ422977.1, OR229085.1, OR229158.1, OR229086.1, OR842570.1, OQ780866.1, OR842569.1, OR842571.1, OR293248.1, and OR842572.1